> For the complete documentation index, see [llms.txt](https://reclone-latam-uncuyo.gitbook.io/building-a-reagent-collaborative-network-in-latam/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://reclone-latam-uncuyo.gitbook.io/building-a-reagent-collaborative-network-in-latam/colony-pcr.md).

# COLONY PCR

This PCR protocol is designed to confirm successful transformation of plasmids. In this case, the plasmid carrying the open vent mCherry gene includes a T7 promoter and T7 terminator, making it ideal

***

The enzyme used for the amplification will be **Pfu DNA polymerase**, known for its high fidelity and accuracy, making it ideal for confirming insert integrity.

***

### 🧪<mark style="color:red;">PCR Reaction Setup (25 µL per reaction)</mark>

| 10× Amplification Buffer  | 2.5 µL  |
| ------------------------- | ------- |
| dNTPs (10 mM)             | 1.0 µL  |
| T7 Forward Primer (10 mM) | 1.0 µL  |
| T7 Reverse Primer (10 mM) | 1.0 µL  |
| **Pfu Polymerase**        | 1.25 µL |
| Colony lysate (template)  | 2.0 µL  |
| DMSO                      | 1.0 µL  |
| MgCl₂                     | 1.25 µL |
| Nuclease-free water       | 14.0 µL |

***

### 🔁 <mark style="color:red;">PCR Cycling Conditions</mark>

| Initial Denaturation | 95 °C     | 30 sec   | 1×  |
| -------------------- | --------- | -------- | --- |
| Denaturation         | 95 °C     | 30 sec   | 34× |
| Annealing            | **55 °C** | 30 sec   |     |
| Extension            | 72 °C     | 6:30 min |     |
| Final Extension      | 72 °C     | 10 min   | 1×  |
| Hold                 | 4 °C      | ∞        | -   |

***

#### 🧬 T7 Primer Sequences

| **T7 Forward** | TAATACGACTCACTATAGGG | Upstream of T7 promoter     |
| -------------- | -------------------- | --------------------------- |
| **T7 Reverse** | CATAACCCCTTGGGGCCTCT | Downstream of T7 terminator |

***

#### 🧾 Notes

* Pick individual colonies with a sterile pipette tip or toothpick, resuspend in 10 µL of sterile water, and use 2 µL as PCR template.
* A correct amplification indicates the presence of the **open vent plasmid**.
* PCR products can be analyzed on a 0,75% agarose gel.