🧫COLONY PCR

This PCR protocol is designed to confirm successful transformation of plasmids. In this case, the plasmid carrying the open vent mCherry gene includes a T7 promoter and T7 terminator, making it ideal

---

The enzyme used for the amplification will be Pfu DNA polymerase, known for its high fidelity and accuracy, making it ideal for confirming insert integrity.

---

🧪PCR Reaction Setup (25 µL per reaction)

10× Amplification Buffer	2.5 µL
dNTPs (10 mM)	1.0 µL
T7 Forward Primer (10 mM)	1.0 µL
T7 Reverse Primer (10 mM)	1.0 µL
Pfu Polymerase	1.25 µL
Colony lysate (template)	2.0 µL
DMSO	1.0 µL
MgCl₂	1.25 µL
Nuclease-free water	14.0 µL

---

🔁 PCR Cycling Conditions

Initial Denaturation	95 °C	30 sec	1×
Denaturation	95 °C	30 sec	34×
Annealing	55 °C	30 sec
Extension	72 °C	6:30 min
Final Extension	72 °C	10 min	1×
Hold	4 °C	∞	-

---

🧬 T7 Primer Sequences

T7 Forward	TAATACGACTCACTATAGGG	Upstream of T7 promoter
T7 Reverse	CATAACCCCTTGGGGCCTCT	Downstream of T7 terminator

---

🧾 Notes

• Pick individual colonies with a sterile pipette tip or toothpick, resuspend in 10 µL of sterile water, and use 2 µL as PCR template.

• A correct amplification indicates the presence of the open vent plasmid.

• PCR products can be analyzed on a 0,75% agarose gel.